TY  - JOUR
TT  - Partial Capsid Protein Gene Sequence Analysis of Apple Mosaic Virus Infecting Apple, Plum and Hazelnut in Turkey
AU  - Akbaş, Birol
AU  - Değirmenci, Kemal
PY  - 2014
DA  - April
JF  - The Journal of Turkish Phytopathology
PB  - Türkiye Fitopatoloji Derneği
WT  - DergiPark
SN  - 0378-8024
SP  - 1
EP  - 8
VL  - 41
IS  - 1-2-3
KW  - Apple
KW  - Plum
KW  - 
KW  - Hazelnut
N2  - Coat protein (CP)sequences of Apple mosaic virus (ApMV)isolates were obtained from apple, plum and hazelnut. These isolates wereinitially tested by DAS-ELISA. Five out of 38 randomly selected apple, hazelnutand plum trees in Isparta, Düzce and Amasya provinces, respectively were ApMV-infectedfor determining similarities or differences among Turkish ApMV isolates. Theisolates were collected in 2008-2010. Amplification of target regions ofselected five isolates was conducted by RT-PCR using coat protein specificprimers. PCR products gave bands of 262 bp in gel electrophoresis. Sequencedata of 262 bp of the partial coat protein region of the ApMV isolates wereobtained using F 5’AGTAATCCGAAAGGTCCGAATCCGAT 3’primer. All sequences were compared with ApMV sequences in NCBI and oursequences showed 88-99% similarities with those. Our isolates accession numbersare as follows: HM245753, HM490310, HM490311, HM245751, HM245752. They werelocated in the same group and it was not seen any differences among them.
UR  - https://dergipark.org.tr/en/pub/fitopatoloji/issue//180930
L1  - https://dergipark.org.tr/en/download/article-file/160336
ER  -