Semptomatik veya asemptomatik primer hiperparatiroidisi olan hastaların biyokimyasal parametreleri ile CDKN1B mutasyon analizi tayini

Yıl 2022, Cilt: 47 Sayı: 2, 852 - 860, 30.06.2022

Gamze Akkuş , Nur Sinem Şengöz Coşkun , Baris Karagün , Bekir Tamer Tetiker

https://doi.org/10.17826/cumj.1095425

Öz

Amaç: Bu çalışmada semptomatik ve asemptomatik primer hiperparatiroidi (PHPT) olgularını karşılaştırmayı amaçladık, beraberinde sporadik saptanan paratiroid adenomlarında etyopatogenezde CDKN1B mutasyonu varlılığını saptamaya çalıştık.
Gereç ve Yöntem: Çalışmamıza kliniğimize başvuran 80 PHPT (66 K ve 14 E, ortalama yaş 50.8 ± 12.01 yıl) tanısı almış hasta dahil edilmiştir. Hastaların yaş, cinsiyet, biyokimyasal parametreleri, görüntüleme yöntemleri (nükleer sintigrafi, ultrasonografi, kemik dansitometre ölçümü) kayıt edilmiştir. CDKN1B gen sekanslaması için GeneMATRIX Quick Blood DNA Purification kiti kullanılarak DNA izole edilmiştir. CDKN1BF (rs786201010, c.-456_-453delCCTT) (CAGGTTTGTTGGCAGCAGTA) ve CDKN1BR (rs786201010, c.-456_-453delCCTT) (GGAGCCAAAAGACACAGACC) primerleri seçilerek mutasyon analizi yapılmıştır.
Bulgular: Çalışma sonucunda 22 hasta asemptomatik PHPT olarak tanımlanmış olup semptomatik PHPT (n=68) serum kalsiyum parametreleri ve 24 saatlik idrar Ca+ atılımı daha yüksek olarak saptanmıştır. Serum Parathormon (PTH) değerleri her iki grupta da benzerdi. Her iki grupta da CDKN1B mutasyonu açısından patolojik bir bulgu saptanmamıştır.
Sonuç: Parathormon seviyeleri semptomatik veya asemptomatik PHPT olgularında belirleyici bir parametre olmamakla birlikte semptomatik PHPT da serum kalsiyum değerleri ve 24 saatlik idrar Ca+ atılımı daha belirgindir.

Anahtar Kelimeler

Primer Hiperparatiroidi, semptomatik hiperparatiroidi, asemptomatik hiperparatiroidi

CDKN1B mutation analyses and biochemical characteristics in patients with symptomatic or asymptomatic primary hyperparathyroidism

Öz

Purpose: The aim of this study was to compare clinical, biochemical and treatment modalities of the patients with symptomatic and asymptomatic PHPT (primary hyperparathyroidism), and evaluate whether the CDKN1B mutation from these patients contributes to the pathogenesis of typical, sporadic parathyroid adenomas.
Materials and Methods: In this prospective study 80 patients (66 women and 14 men, mean age 50.8 ± 12.01 years) with PHPT were enrolled. Biochemical and clinical information were collected on patients’ sex, age, biochemical examination and radiological findings (nuclear 99 mTc sestamibi scans scintigraphy, cervical ultrasound). CDKN1B sequencing, and DNA isolation was performed by using GeneMATRIX Quick Blood DNA Purification Kit. Selected primer of CDKN1BF (rs786201010, c.-456_-453delCCTT) (CAGGTTTGTTGGCAGCAGTA) and CDKN1BR (rs786201010, c.-456_-453delCCTT) (GGAGCCAAAAGACACAGACC) were amplified by polymerase chain reaction (PCR) (Solis Biodyne, Estonia).
Results: A total of 80 patients diagnosed with PHPT were included, of which 22 were symptomatic. Serum calcium and 24-hour calcium excretion were significantly increased in patients with symptomatic PHTP. Serum PTH levels were similar between the two group. PHPT. CDKN1B mutation was not detected in any patients.
Conclusion: Symptomatic patients were found to have elevated levels of calcium levels (hypercalcaemic), 24-hour urine calcium excretion and target organ damage (bone disease and nephrolithiasis). Independent of PTH levels, clinical signs and symptoms could be related with serum calcium parameters in these patients.

Anahtar Kelimeler

Primary Hyperparathyroidism, symptomatic hyperparathyroidism, asymptomatic hyperparathyroidism

Kaynakça

• 1) Rubin MR, Bilezikian JP, McMahon DJ, Jacobs T, Shane E, Siris E, Udesky J, Silverberg SJ. The natural history of primary hyperparathyroidism with or without parathyroid surgery after 15 years. J Clin Endocrinol Metab. 2008;93:3462–70. doi: 10.1210/jc.2007-1215
• 2) Rejnmark L, Vestergaard P, Mosekilde L. Nephrolithiasis and renal calcifications in primary hyperparathyroidism. J Clin Endocrinol Metab. 2011;96:2377–85. doi: 10.1210/jc.2011-0569.
• 3) Stein EM, Silva BC, Boutroy S, Zhou B, Wang J, Udesky J, Zhang C, McMahon DJ, Romano M, Dworakowski E, Costa AG, Cusano N, Irani D, Cremers S, Shane E, Guo XE, Bilezikian JP. Primary hyperparathyroidism is associated with abnormal cortical and trabecular microstructure and reduced bone stiffness in postmenopausal women. J Bone Miner Res. 2013;28:1029–40. doi: 10.1002/jbmr.1841
• 4)Walker M, Blezikian J. Primary Hyperparathyroidism: recent advances. Current Opin .Rheumatol. 2018;30(4):427-439
• 5) Rosario P.W. Primary hyperparathyroidism with normal calcium and PTH World J Surg, 2017;41:1649-1650
• 6) Udelsman R, Akerstrom G, Biagini C, et al. The surgical management of asymptomatic primary hyperparathyroidism: proceedings of the Fourth International Workshop. J Clin Endocrinol Metabol, 2014;99:3595-3606
• 7) Stephen A.E, Mannstadt M, Hodin R.A. Indications for surgical management of hyperparathyroidism: a review. JAMA Surg, 2017; 152:878-882
• 8) Sun B, Guo B, Wu B, et al. Characteristics, management, and outcome of primary hyperparathyroidism at a single clinical center from 2005 to 2016 Osteoporos Int, 2018; 29(3): 635-642
• 9) Egan RJ, Scott- Coombes DM. The surgical management of sporadic hyperparathroidism. Best. Pract. Res. Clin Metab. 2018;32(6):847-859
• 10) Lumachi F, Zucchetta P, Marzola MC et al (2000) Advantages of combined technetium-99m-sestamibi scintigraphy and high-resolution ultrasonography in parathyroid localization: comparative study in 91 patients with primary hyperparathyroidism. Eur J Endocrinol 143:755–760
• 11) Clarke BL. Asymptomatic Primary Hyperparathyroidism. Front. Horm. Res. 2019;51:13-22
• 12) Cetani F, Saponaro F, Borsari S, Mercocci C. Familyal and Hereditary forms of Primary Hyperparathyroidism. Front. Horm. Res. 2019;51:40-51
• 13) Marx SJ. Multiple endocrine neoplasia type 1. In: Scriver CR Beaudet AL, Sly WS, Valle D, eds. The metabolic and molecular bases of inherited disease, 8th Ed. New York: McGraw-Hill; 2001;943-966
• 14) Eng C, Clayton D, Schuffenecker 1, et al. 1996 The relationship between specific RET proto-oncogene mutations and disease phenotype in multiple endocrine neoplasia type 2. International RET mutation consortium analysis. JAMA 2001;276:1575-579
• 15) Alrezk M, Hannah-Shmouni F, Stratakis C. MEN4 and CDKN1B mutations: The latest of the MEN syndromes. Endocrine Related Cancer. 2017;24(10):195-208
• 16) Bradley KJ, Cavaco BM, Bowl MR, Harding B, Cranston T, Fratter C, Besser GM, Conceicao Pereira M, Davie MW, Dudley N, et al. Parafibromin mutations in hereditary hyperparathyroidism syndromes and parathyroid tumours. Clin Endocrinol (Oxf) 2006;64:299–306
• 17) Lee JY, Shoback DM. Familial hypocalicuric hypercalcemia and related disorders. Best Practice Res. Clin Endocrinol Metab 2018;32(5):609-619
• 18) Chiofalo MG, Sparaneo A, Chetta M, Franco R, Baorda F, Cinque L, Granatiero M, D’Agruma L, Pezzullo L, Scillitani A, et al. A novel CDC73 gene mutation in an Italian family with hyperparathyroidism-jaw tumour (HPT-JT) syndrome. Cellular oncology. 2014;37:281–288.
• 19) Agarwal SK, Mateo CM, Marx SJ. Rare germline mutations in cyclin-dependent kinase inhibitor genes in multiple endocrine neoplasia type 1 and related states. J Clin Endocrinol Metab. 2009b;94:1826–1834.
• 20) Belar O, De La Hoz C, Perez-Nanclares G, Castano L, Gaztambide S, Spanish MENG. Novel mutations in MEN1, CDKN1B and AIP genes in patients with multiple endocrine neoplasia type 1 syndrome in Spain. Clin Endocrinol (Oxf) 2012;76:719–724.
• 21) Crona J, Gustavsson T, Norlen O, Edfeldt K, Akerstrom T, Westin G, Hellman P, Bjorklund P, Stalberg P. Somatic Mutations and Genetic Heterogeneity at the CDKN1B Locus in Small Intestinal Neuroendocrine Tumors. Ann Surg Oncol. 2015;22(Suppl 3):S1428–1435.
• 22) Zhao L, Liu JM, He XY, Zhao HY, Sun LH, Tao B, Zhang MJ, Chen X, Wang WQ, Ning G (2013) The changing clinical patterns of primary hyperparathyroidism in Chinese patients: data from 2000 to 2010 in a single clinical center. J Clin Endocrinol Metab 98:721–28
• 23) Macfarlane D, Ning Yu, Leese G. Asymptomatic and mild Primary Hyperparathyroidism. Ann Endocrinol. 2015;76(2):120-127
• 24) Wade TJ, Yen TW, Amin AL, et al. Surgical management of normocalcemic primary hyperparathyroidism. World J Surg, 36 (4) (2012), pp. 761-766
• 25) Shah VN, Bhadada S, Bhansali A, Behera A, Mittal BR. Changes in clinical & biochemical presentations of primary hyperparathyroidism in India over a period of 20 years. Indian J Med Res. 2014;139:694–99.
• 26) Pallan S, Rahman MO, Khan AA (2012) Diagnosis and management of primary hyperparathyroidism. BMJ 344:e1013. doi:10.1136/bmj.e1013:e1013
• 27) Odvina CV, Sakhaee K, Heller HJ, Peterson RD, Poindexter JR, Padalino PK, Pak CY. Biochemical characterization of primary hyperparathyroidism with and without kidney stones. Urol Res. 2007;35:123–28. doi: 10.1007/s00240-007-0096-2.
• 28) Tay YD, Liu M, Bandeira L, Bucovsky M, Lee JA, Silverberg SJ et al (2018) Occult urolithiasis in asymptomatic primary hyperparathyroidism. Endocr Res 43:106–115
• 29) Blezikian J.P., Khan A, Potts J et al. Guidelines for the Management of Asymptomatic Primary Hyperparathyroidism: Summary Statement from the Third International Workshop. J Clin Endocrinol Metab. 2009;94(2):335-339
• 30) Bilezikian J.P.,Brandi, M.L, Eastell R, et al. Guidelines for the management of asymptomatic primary hyperparathyroidism: summary statement from the Fourth International Workshop. J Clin Endocrinol Metabol, 99 (10) (2014 Oct), pp. 3561-3569
• 31) Rao DS, Phillips ER, Divine GW, Talpos GB (2004) Randomized controlled clinical trial of surgery versus no surgery in patients with mild asymptomatic primary hyperparathyroidism. J Clin Endocrinol Metab 89:5415–5422
• 32) Eufroziano C, Veres A, Bandeira F. Epidemiology of Primary Hyperparathyroidism and its Non-classical Manifestations in the City of Recife, Brazil. Clin Med Insights Endocrinol Diabetes. 2013;4(6):69-74
• 33) Tassone F, Guarnieri A, Castellano E, Baffoni C, Attanasio R, Borretta G. Parathyroidectomy halts the deterioration of renal function in primary hyperparathyroidism. J Clin Endocrinol Metab. 2015;100:3069–73. doi: 10.1210/jc.2015-2132.
• 34) Cipriani C, Biamonte F, Costa AG, Zhang C, Biondi P, Diacinti D et al. Prevalence of kidney stones and vertebral fractures in primary hyperparathyroidism using imaging technology. J Clin Endocrinol Metab 2015;100:1309–1315
• 35) Pierreux J, Bravenboer B. Normocalcemic Primary Hyperparathyroidism: A Comparison with the Hypercalcemic Form in a Tertiary Referral Population. Horm. Metab Res 2018;50(11):797-802
• 36) Charopoulos I, Tournis S, Trovas G et al. Effect of primary hyperparathyroidism on volumetric bone mineral density and bone geometry assessed by peripheral quantitative computed tomography in postmenopausal women. J Clin Endocrinol Metab. 2006; 91: 1748-1753
• 37) Castellano E, Attanasio R, Gianotti L, Tassone F, Borreta G. Forearm DXA Increases the Rate of Patients With Asymptomatic Primary Hyperparathyroidism Meeting Surgical Criteria. J Clin Endocrinol Metab. 2016;101(7):2728-32
• 38) Singer MC, Pucar D, Mathew M, Terris DJ. Improved localization of sestamibi imaging at high-volume centers. Laryngoscope. 2013;123:298–301. doi: 10.1002/lary.23675.
• 39) Wong KK, Fig LM, Gross MD, Dwamena BA. Parathyroid adenoma localization with 99mTc-sestamibi SPECT/CT: a meta-analysis. Nucl Med Commun. 2015;36:363–75. doi: 10.1097/MNM.0000000000000262
• 40) Starker LF, Mahajan A, Bjorklund P, Sze G, Udelsman R, Carling T. 4D parathyroid CT as the initial localization study for patients with de novo primary hyperparathyroidism. Ann Surg Oncol. 2011;18:1723–28. doi: 10.1245/s10434-010-1507-0.
• 41) De Feo ML, Colagrande S, Biagini C et al (2000) Parathyroid glands: combination of (99 m) Tc MIBI scintigraphy and US for demonstration of parathyroid glands and nodules. Radiology 214:393–402
• 42) Lundgren E, Lind L, Palmer M, Jakobsson S, Ljunghall S, Rastad J. Increased cardiovascular mortality and normalized serum calcium in patients with mild hypercalcemia followed up for 25 years. Surgery. 2001;130:978–85. doi: 10.1067/msy.2001.118377.
• 43) Redman S, Graham R, Little D. Parathyroid Scintigraphy. Nucl Med Common. 2019;40(9):1-3
• 44) Wachtel H, Bartlett E, Rachel K, Cerullo I, Karakousis G, Fraker D. Primary hyperparathyroidism with negative imaging: a significant clinical problem. Ann Surg 2014;260(3):474-80
• 45) Zwolak A, Rudzki G, Swirska J, Dudzinska M, Daniluk J, Tarach J. Catecholamine crisis as a first manifestation of familial bilateral pheochromocytoma caused by RET proto-oncogene mutation in codon C 634R. Endokrynol Pol. 2015;66:462–468.
• 46) Georgitsi M, Raitila A, Karhu A, van der Luijt RB, Aalfs CM, Sane T, Vierimaa O, Makinen MJ, Tuppurainen K, Paschke R, et al. Germline CDKN1B/p27Kip1 mutation in multiple endocrine neoplasia. J Clin Endocrinol Metab. 2007;92:3321–3325
• 47) Stratakis CA, Tichomirowa MA, Boikos S, Azevedo MF, Lodish M, Martari M, Verma S, Daly AF, Raygada M, Keil MF, et al. The role of germline AIP, MEN1, pRKAR1A, CDKN1B and CDKN2C mutations in causing pituitary adenomas in a large cohort of children, adolescents, and patients with genetic syndromes. Clin Genet. 2010;78:457–463.