Research Article
BibTex RIS Cite

Adana, Mersin ve Hatay illerinde Citrus chlorotic dwarf associated virus hastalığının yaygınlığı

Year 2018, Volume: 33 Issue: 1, 57 - 62, 29.06.2018
https://izlik.org/JA27JB35XM

Abstract

Bu sörvey programı Doğu Akdeniz bölgesi turungil alanlarında 1980’li
yılların ortalarında ilk defa belirlenen Citrus chlorotic dwarf (CCD, Turunçgil
klorotik cüceleşme) hastalığının son yaygınlık durumunu belirlemek için
yapılmıştır. Hastalık ilk belirlendiği yıllardan günümüze kadar bölge için çok
önemli hastalıklardan biri haline gelmiştir. Hastalık, günümüze kadar çok hızlı
bir şekilde yayılma göstermiştir. CCD hastalığı Türkiye turunçgil tarımının
yaklaşık % 85’ inin yapıldığı Doğu Akdeniz bölgesinde görülmektedir.
Türkiye’nin diğer turunçgil yetiştirilen alanlarında henüz rapor edilmemiştir.
Doğu Akdeniz bölgesi turunçgil alanlarında yapılan sörvey sonuçlarına göre
limonlarda %36, mandarinlerde %25,3, portakallarda % 17,6 ve altıntoplarda
%17,5 oranında infeksiyon gözlenmiştir. Sörvey makroskopik gözlemlere göre
hastalık simptomlarına bakılarak yapılmıştır. Hastalık olduğu belirlenen
bahçelerden 50 adet örnek alınmış ve bu örnekler PCR yöntemi ile analiz
edilmiştir. PCR çalışmaları forward (5′- gttctgtgtttcgacccgtt -3′) ve reverse
(5′- gggattcgcatggatagctcatccaa -3′) primerleri kullanılarak yapılmış ve daha
sonra yürütülen agar jel çalışmaları sonucu 444 bp seviyesinde bandlar
gözlenmiştir. 

References

  • Çınar, A., Kersting, U., Önelge, N., Korkmaz, S., Şaş, G., 1993. Citrus virüs and virus- like disease in the eastern Mediterranean region of Turkey. In: Moreno, P., da Graça, J.V., Timmer, L.W. (Eds.). Proceedings of the 12th Conference of International Organization of Citrus Virologist, IOCV. Riverside, pp. 397–400.
  • European Food Safety Authority, 2008. Pest risk assessment made by France on citrus chlorotic dwarf virus considered by France as harmful in the French overseas departments of French Guiana, Guadeloupe, Martinique and Re´ union. EFSA J. 684, 1–17.
  • Kersting, U., Korkmaz, S., Çınar, A., Ertuğrul, B., Önelge, N., Garnsey, S. M., 1996. Citrus chlorotic dwarf: A new White fly-transmitted disease in the east Mediterranean region of Turkey. In: da Graça, J.V., Moreno, P., Yokomi, R. (Eds.). Proceedings of the 13th Conference of International Organizationof Citrus Virologist, IOCV. Riverside, pp. 220–225.
  • Korkmaz, S., Çınar, A., Bozan, O., Kersting, U., 1994a. Distribution and natural transmission of a new whitefly-borne virüs disease of citrus in the eastern Mediterranean region of Turkey. In: Proceedings of the 9th Congress of the Mediterranean Phytopathological Union, pp. 437–439.
  • Korkmaz, S., Çınar, A., Demirer, E., Önelge, N., 1994b. Greenhouse observation on the susceptibility of 36 citrus varieties to a new whitefly-borne virus. In: Proceedings of the 9th Congress of the Mediterranean Phytopathological Union, pp. 305–306.
  • Korkmaz, S., Garnsey, S.M., 2000. Major virus disease: chlorotic dwarf. In: Timmer, P., Garnsey, S.M., Graham, T. (Eds.), In: Compendium of Citrus Diseases, 2nd Edition Pub. APS Press, pp. 55–56.
  • Loconsole G., Saldarelli P., Doddapaneni H., Savino V., Martelli G.P., Saponari M., 2012. Identification of a single-stranded DNA virüs associated with citrus chlorotic dwarf disease, a new member in the family Geminiviridae. Virology 432 (2012) 162–172
  • J. Guo, X. P. Lai, J. X. Li, J. Q. Yue, S. Y. Zhang, Y. Y. Li, J. Y. Gao, Z. R. Wang, H. F. Duan, and J. D. Yang, 2015. First Report on Citrus Chlorotic Dwarf Associated Virus on Lemon in Dehong Prefecture, Yunnan, China. Plant dise ase 99, 1287.

Year 2018, Volume: 33 Issue: 1, 57 - 62, 29.06.2018
https://izlik.org/JA27JB35XM

Abstract

References

  • Çınar, A., Kersting, U., Önelge, N., Korkmaz, S., Şaş, G., 1993. Citrus virüs and virus- like disease in the eastern Mediterranean region of Turkey. In: Moreno, P., da Graça, J.V., Timmer, L.W. (Eds.). Proceedings of the 12th Conference of International Organization of Citrus Virologist, IOCV. Riverside, pp. 397–400.
  • European Food Safety Authority, 2008. Pest risk assessment made by France on citrus chlorotic dwarf virus considered by France as harmful in the French overseas departments of French Guiana, Guadeloupe, Martinique and Re´ union. EFSA J. 684, 1–17.
  • Kersting, U., Korkmaz, S., Çınar, A., Ertuğrul, B., Önelge, N., Garnsey, S. M., 1996. Citrus chlorotic dwarf: A new White fly-transmitted disease in the east Mediterranean region of Turkey. In: da Graça, J.V., Moreno, P., Yokomi, R. (Eds.). Proceedings of the 13th Conference of International Organizationof Citrus Virologist, IOCV. Riverside, pp. 220–225.
  • Korkmaz, S., Çınar, A., Bozan, O., Kersting, U., 1994a. Distribution and natural transmission of a new whitefly-borne virüs disease of citrus in the eastern Mediterranean region of Turkey. In: Proceedings of the 9th Congress of the Mediterranean Phytopathological Union, pp. 437–439.
  • Korkmaz, S., Çınar, A., Demirer, E., Önelge, N., 1994b. Greenhouse observation on the susceptibility of 36 citrus varieties to a new whitefly-borne virus. In: Proceedings of the 9th Congress of the Mediterranean Phytopathological Union, pp. 305–306.
  • Korkmaz, S., Garnsey, S.M., 2000. Major virus disease: chlorotic dwarf. In: Timmer, P., Garnsey, S.M., Graham, T. (Eds.), In: Compendium of Citrus Diseases, 2nd Edition Pub. APS Press, pp. 55–56.
  • Loconsole G., Saldarelli P., Doddapaneni H., Savino V., Martelli G.P., Saponari M., 2012. Identification of a single-stranded DNA virüs associated with citrus chlorotic dwarf disease, a new member in the family Geminiviridae. Virology 432 (2012) 162–172
  • J. Guo, X. P. Lai, J. X. Li, J. Q. Yue, S. Y. Zhang, Y. Y. Li, J. Y. Gao, Z. R. Wang, H. F. Duan, and J. D. Yang, 2015. First Report on Citrus Chlorotic Dwarf Associated Virus on Lemon in Dehong Prefecture, Yunnan, China. Plant dise ase 99, 1287.
There are 8 citations in total.

Details

Primary Language Turkish
Subjects Agricultural Engineering
Journal Section Research Article
Authors

Orhan Bozan

Nüket Önelge

Publication Date June 29, 2018
IZ https://izlik.org/JA27JB35XM
Published in Issue Year 2018 Volume: 33 Issue: 1

Cite

APA Bozan, O., & Önelge, N. (2018). Adana, Mersin ve Hatay illerinde Citrus chlorotic dwarf associated virus hastalığının yaygınlığı. Çukurova Tarım Ve Gıda Bilimleri Dergisi, 33(1), 57-62. https://izlik.org/JA27JB35XM
AMA 1.Bozan O, Önelge N. Adana, Mersin ve Hatay illerinde Citrus chlorotic dwarf associated virus hastalığının yaygınlığı. Çukurova J. Agric. Food. Sciences. 2018;33(1):57-62. https://izlik.org/JA27JB35XM
Chicago Bozan, Orhan, and Nüket Önelge. 2018. “Adana, Mersin Ve Hatay Illerinde Citrus Chlorotic Dwarf Associated Virus Hastalığının Yaygınlığı”. Çukurova Tarım Ve Gıda Bilimleri Dergisi 33 (1): 57-62. https://izlik.org/JA27JB35XM.
EndNote Bozan O, Önelge N (June 1, 2018) Adana, Mersin ve Hatay illerinde Citrus chlorotic dwarf associated virus hastalığının yaygınlığı. Çukurova Tarım ve Gıda Bilimleri Dergisi 33 1 57–62.
IEEE [1]O. Bozan and N. Önelge, “Adana, Mersin ve Hatay illerinde Citrus chlorotic dwarf associated virus hastalığının yaygınlığı”, Çukurova J. Agric. Food. Sciences, vol. 33, no. 1, pp. 57–62, June 2018, [Online]. Available: https://izlik.org/JA27JB35XM
ISNAD Bozan, Orhan - Önelge, Nüket. “Adana, Mersin Ve Hatay Illerinde Citrus Chlorotic Dwarf Associated Virus Hastalığının Yaygınlığı”. Çukurova Tarım ve Gıda Bilimleri Dergisi 33/1 (June 1, 2018): 57-62. https://izlik.org/JA27JB35XM.
JAMA 1.Bozan O, Önelge N. Adana, Mersin ve Hatay illerinde Citrus chlorotic dwarf associated virus hastalığının yaygınlığı. Çukurova J. Agric. Food. Sciences. 2018;33:57–62.
MLA Bozan, Orhan, and Nüket Önelge. “Adana, Mersin Ve Hatay Illerinde Citrus Chlorotic Dwarf Associated Virus Hastalığının Yaygınlığı”. Çukurova Tarım Ve Gıda Bilimleri Dergisi, vol. 33, no. 1, June 2018, pp. 57-62, https://izlik.org/JA27JB35XM.
Vancouver 1.Orhan Bozan, Nüket Önelge. Adana, Mersin ve Hatay illerinde Citrus chlorotic dwarf associated virus hastalığının yaygınlığı. Çukurova J. Agric. Food. Sciences [Internet]. 2018 Jun. 1;33(1):57-62. Available from: https://izlik.org/JA27JB35XM

From January 1, 2016 “Çukurova University Journal of Faculty of Agriculture” continuous its publication life as “Çukurova Journal of Agriculture and Food Sciences”.