Morphlogical and Molecular Characterization of Rotylenchulus borealis Loof and Oostenbrink, 1962 from Turkey

Year 2022, Volume: 9 Issue: 2, 244 - 255, 23.04.2022

Faruk Akyazı , Buğra Güvercin , Onur Yılmaz

https://doi.org/10.30910/turkjans.1005585

Cited By: 1

Abstract

Reniform nematodes (Rotylenchulus spp.) have been reported to be associated with a large number of important products all over the world, ranging from important cereals, vegetables and ornamental plants. In this study, morphologic and molecular characters were used to idetify Rotylenchulus population obtained from a soybean field in Adana province of Turkey. Nematodes were extracted from the soil using a modified baermann funnel method. The morphological characters and morphometrics of male and immature females were examined and compared with previous studies. For molecular characterisation, DNA was extracted from immature females and the D2-D3 expansion region of the 28S rRNA gene was amplified using primer pair D2A (5’ACA AGTACCGTGAGGGAAAGTTG 3’) and D3B (5’ TCGGAAGGAACCAGCTACTA 3’). PCR product (780 bp) was sequenced and then compared with sequences of Rotylenchulus species available in the GenBank database. The result obtained from morphologic and molecular studies showed that the reniform nematode population was Rotylenchulus borealis.

Keywords

Rotylenchulus borealis, soybean, Reniform nematodes, D2A, D3B.

Rotylenchulus borealis Loof and Oostenbrink, 1962’in morfolojik ve moleküler Karekterizasyonu

Abstract

Reniform nematodların (Rotylenchulus spp.), tüm dünyada hububattan sebze ve süs bitkilerine kadar birçok önemli ürünlerle ilişkili olduğu rapor edilmiştir. Bu çalışmada, Adana ilinde soya fasulyesi üretimi yapılan bir alandan alınan toprak örneklerinden elde edilen Rotylenchulus popülasyonuna ait bir tür, morfolojik ve moleküler yöntemler kullanılarak teşhis edilmiştir. Topraktaki nematodlar, modifiye Baermann huni yöntemi kullanılarak ekstrakte edilmiştir. Tür teşhisi için ilk olarak morfolojik ve morfometrik karakterler ölçülmüş ve önceki çalışmalarla karşılaştırılmıştır. Moleküler karakter özellikleri için, olgunlaşmamış dişilerden DNA izole edilerek ve 28S rRNA geninin D2-D3 genişleme bölgesine ait primer çifti, D2A (5’ ACAAGTACCGTGAGGGAAAGTTG 3’) ve D3B (5’ TCGGAAGGAACCAGCTACTA 3’) kullanılarak amplifiye edilmiştir. PCR ürünü (780 bp) dizi analizinin ardından GenBank veri tabanında bulunan Rotylenchulus türlerinin dizileriyle karşılaştırıldı. Çalışmada morfolojik, morfometrik ve moleküler olarak incelenen reniform nematod popülasyonu R. borealis olarak tespit edilmiştir.

Keywords

Rotylenchulus borealis, Soya fasülyesi, Reniform nematodes, D2A, D3B.

References

• References Bello, A. 1972. Rotylenchulus borealis en los cultivos de agrios (Citrus spp.) del levante espagnol. Nematropica 2:25.
• Dasgupta D. R., D. J. Raski and S. A. Sher 1968. A revision of the genus Rotylenchulus Linford and Oliveira 1940 (Nematoda: Tylenchidae). Proceedings of the Helminthological Society of Washington, 35, 169–172.
• De Ley, P., Félix, M. A., Frisse, L. M., Nadler, S. A., Sternberg, P. W., and Thomas, K. W. 1999. Molecular and morphological characterisation of two reproductively isolated species with mirror-image anatomy (Nematoda: Cephalobidae). Nematology, 1, 591–612.
• Devran, Z., and Söğüt, M. A. 2009. Distribution and identification of root-knot nematodes from Turkey. Journal of Nematology, 41(2), 128.
• Elekcioglu, I. H., Ohnesorge, B., Lung, G., and Uygun, N. 1994. Plant parasitic nematodes in the east Mediterranean region of Turkey. Nematologia Mediterranea, 22(1), 59-63.
• Fortuner, R. 1987. A reappraisal of Tylenchina (Nemata). 8. The family Hoplolaimidae Filip’ev, 1934. Revue de Nématologie, 10(2), 219-232.
• Gava, R., Da Silva, T. R., Cotrim, M. F., Abreu, A. B. L., Anselmo, J. L., and Teodoro, P. E. 2020. Irrigation management in soybean crops influences the occurrence of nematodes in the soil. Bioscience Journal, 36(5).
• Germani, G. 1978. Caracters morphobiometriques de trois especes ouestafricaines de Rotylenchulus Linford & Oliveira, 1940 (Nematoda: Tylenchida). Rev. Nematol. 1:241-250.
• Germershausen, K., Günther, P. 1984. Rotylenchulus borealis Loof & Oostenbring, 1962 in der DDR. Nacr. Bl. Ptl.- Schutzdienst DDR, 38: 91. Hall, T. A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. In Nucleic acids symposium series 41(41), 95-98.
• Hooper, D.J., 1986. Laboratory methods for work with plant and soil nematodes, Reference book 402, J.F. Southey, ed. (London, UK: Ministry of Agriculture, Fisheries and Food).
• Kumar, S., Stecher, G., and Tamura, K. 2016. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular biology and evolution, 33(7), 1870-1874.
• Lišková, M., Troccoli, A., Vovlas, N., & Sasanelli, N. 2002. On the occurrence of Rotylenchulus borealis in the Slovak Republic. Helminthologia, 39(3), 165-167.
• Loof, P. A. A., and M. Oostenbrink. 1962. Rotylenchulus borealis n. sp. with a key to the species of Rotylenchulus. Nematologica 7:83-90.
• Mcdonald, A., Fourie, H., and Loots, G. 2001. Plant-parasitic nematodes in field crops in South Africa. 6. Soybean. Nematology, 3(5), 447-454.
• Palomares-Rius, J. E., Cantalapiedra-Navarrete, C., Archidona-Yuste, A., Tzortzakakis, E. A., Birmpilis, I. G., Vovlas, N., ... & Castillo, P. 2018. Prevalence and molecular diversity of reniform nematodes of the genus Rotylenchulus (Nematoda: Rotylenchulinae) in the Mediterranean Basin. European journal of plant pathology, 150(2), 439-455.
• Palomares-Rius, J. E., Clavero-Camacho, I., Archidona-Yuste, A., Cantalapiedra-Navarrete, C., León-Ropero, G., Braun Miyara, S. and Castillo, P. 2021. Global distribution of the reniform nematode genus Rotylenchulus with the Synonymy of Rotylenchulus macrosoma with Rotylenchulus borealis. Plants, 10(1), 1-24.
• Robinson, A. F., Inserra, R. N., Caswell-Chen, E. P., Vovlas, N., and Troccoli, A. 1997. Rotylenchulus species: Identification, distribution, host ranges, and crop plant resistance. Nematropica, 27(2), 127-180.
• Ryss, A. 1992. Some records of plant parasitic nematodes (Nematoda, Tylenchida) from Estonia. Eesti Teaduste Akadeemia Toimetised, Bioloogia, 41(2), 72-76.
• Sipes B. S, Schmitt D. P. 2000. Rotylenchulus reniformis damage thresholds on pineapple. Acta Horticulturae, 529: 239-245.
• So, S., Garan, Y., Miyahara, K., & Ohshima, Y., 2012. Body size change in various nematodes depending on bacterial food, sex and growth temperature. In Worm 1(2), 93-97.
• Tan, A., and Ökten, M., 2008. Tylenchid nematodes associated with melon growing in Diyarbakir province, Turkey. International Journal of Nematology, 18(2), 235-243.
• Van Den Berg, E., Marais, M., Gaidashova, S., and Tiedt, L. R. 2003. Hoplolaimidae Filip'ev, 1934 (Nemata) from Rwandan banana fields. African Plant Protection, 9(1), 31-42.
• Vovlas, N., Subbotin, S. A., Troccoli, A., Liebanas, G., and Castillo, P. 2008. Molecular phylogeny of the genus Rotylenchus (Nematoda, Tylenchida) and description of a new species. Zoologica Scripta, 37(5), 521-537.
• Wang, K., 2019. Reniform nematode. http://entnemdept.ufl.edu/creatures/nematode/r_reniformis.htm