Reniform nematodes (Rotylenchulus spp.) have been reported to be associated with a large number of important products all over the world, ranging from important cereals, vegetables and ornamental plants. In this study, morphologic and molecular characters were used to idetify Rotylenchulus population obtained from a soybean field in Adana province of Turkey. Nematodes were extracted from the soil using a modified baermann funnel method. The morphological characters and morphometrics of male and immature females were examined and compared with previous studies. For molecular characterisation, DNA was extracted from immature females and the D2-D3 expansion region of the 28S rRNA gene was amplified using primer pair D2A (5’ACA AGTACCGTGAGGGAAAGTTG 3’) and D3B (5’ TCGGAAGGAACCAGCTACTA 3’). PCR product (780 bp) was sequenced and then compared with sequences of Rotylenchulus species available in the GenBank database. The result obtained from morphologic and molecular studies showed that the reniform nematode population was Rotylenchulus borealis.
Reniform nematodların (Rotylenchulus spp.), tüm dünyada hububattan sebze ve süs bitkilerine kadar birçok önemli ürünlerle ilişkili olduğu rapor edilmiştir. Bu çalışmada, Adana ilinde soya fasulyesi üretimi yapılan bir alandan alınan toprak örneklerinden elde edilen Rotylenchulus popülasyonuna ait bir tür, morfolojik ve moleküler yöntemler kullanılarak teşhis edilmiştir. Topraktaki nematodlar, modifiye Baermann huni yöntemi kullanılarak ekstrakte edilmiştir. Tür teşhisi için ilk olarak morfolojik ve morfometrik karakterler ölçülmüş ve önceki çalışmalarla karşılaştırılmıştır. Moleküler karakter özellikleri için, olgunlaşmamış dişilerden DNA izole edilerek ve 28S rRNA geninin D2-D3 genişleme bölgesine ait primer çifti, D2A (5’ ACAAGTACCGTGAGGGAAAGTTG 3’) ve D3B (5’ TCGGAAGGAACCAGCTACTA 3’) kullanılarak amplifiye edilmiştir. PCR ürünü (780 bp) dizi analizinin ardından GenBank veri tabanında bulunan Rotylenchulus türlerinin dizileriyle karşılaştırıldı. Çalışmada morfolojik, morfometrik ve moleküler olarak incelenen reniform nematod popülasyonu R. borealis olarak tespit edilmiştir.
Primary Language | English |
---|---|
Journal Section | Research Articles |
Authors | |
Publication Date | April 23, 2022 |
Submission Date | October 6, 2021 |
Published in Issue | Year 2022 Volume: 9 Issue: 2 |