Sığır Mastitis Süt Örneklerinden Stafilokok Türlerinin ve S. aureus'un Teşhisine Yönelik İkili bir PZR Tekniği

Öz

Mastitis is the most costly disease in dairy industry. Staphylococcus spp. is the most frequently isolated microorganisms and Staphylococcus aureus is one of the most important contagious mastitis agents in dairy cattle. The aim of this study is developing a duplex PCR technique for detection of Staphylococcus spp. and S. aureus from culture and milk samples. S. aureus (ATCC 25923) and S. epidermidis (ATCC 12228) DNAs were used as positive control. For the purpose of testing the developed technique, one coagulase-negative Staphylococcus and one S. aureus positive milk sample was used as a clinical sample that they were sent by Veterinary Practitioners. In this study, a duplex and rapid PCR protocol is developed for detecting and separating these organisms from culture and from milk samples. This procedure can be used as an alternative, reliable and fast detection and identification method for Staphylococcus spp. and S. aureus in few hours for deciding treating or culling the cows in farm base in clinical mastitis cases and can be a useful diagnostic method for subclinical mastitis cases too.

Anahtar Kelimeler

• Duplex PCR, Mastitis, Staphylococci, S. aureus

Sığır Mastitis Süt Örneklerinden Stafilokok Türlerinin ve S. aureus'un Teşhisine Yönelik İkili bir PZR Tekniği

Öz

Mastitis süt sığırcılığı endüstrisinin en fazla ekonomik kayba neden olan problemidir. Stafilokok türleri en sık izole edilen etkenler olup, Staphylococcus aureus ise süt sığırlarında en önemli kontagiyöz etkendir. Bu çalışmanın amacı stafilokok türleri ve S. aureus’un kültür ve süt örneklerinden teşhisi için ikili bir PZR tekniğinin geliştirilmesidir. Çalışmada pozitif kontrol olarak, S. aureus (ATCC 25923) ve S. epidermidis (ATCC 12228) DNA’sı kullanıldı. Geliştirilen tekniğin denenmesi amacıyla Veteriner Hekimlerce laboratuvarımıza gönderilen örneklerden bir adet koagulaz negatif stafilokok bir adet de S. aureus pozitif süt örneği klinik örnek olarak kullanıldı. Çalışmada sütten ve kültür örneklerinden stafilokok ve S. aureus’un teşhisi ve ayrımı için ikili ve hızlı bir PZR tekniği geliştirildi. Geliştirilen bu tekniğin stafilokok türleri ve S. aureus’un bir kaç saat içinde hem süt hem de kültür örneklerinden tanısı ve ayrımı için alternatif, güvenilir ve hızlı bir tanı yöntemi olarak özellikle sonuçların çiftlik bazında kullanılmak üzere klinik ve subklinik olgularda ineğin tedavi edilmesi ya da kesime gönderilmesine karar verilmesi amacıyla kullanılabileceği ortaya konuldu.

Anahtar Kelimeler

• Dubleks PZR, Mastitis, Stafilokok, S. aureus

Kaynakça

1. 16s rDNA for Staphylococcus spp. 16s 1 5’- CAGCTCGTGTCGTGAGATGT -3’ 420 bp Strommenger et al., 2003 16s 2 5’- AATCATTTGTCCCACCTTCG-3’
2. Coa gen for S. aureus Coa 1 5’- GCTTCTCAATATGGTCCGAG-3’ 131 bp Schmitz FJ, et al., 1997 Coa 1 5’- CTTGTTGAATCTTGGTCTCGC-3’
3. Then, duplex PCR protocol was developed with some modifications (Henegariu et al., 2003). Duplex PCR reaction was carried out in a final volume of 25 µl. The mixture was consisted of 2 µl of extracted DNA template, 1
4. U of Taq DNA polymerase (Vivantis Technologies), 2,5 µl of 10x PCR buffer (10X ViBuffer A, without MgCl 2 ), 3 mM MgCl 2 , and 200 µM each of dNTPs (VivantisTechnologies). Primers for PCR mixture were added 10 pmol primer each 16s primer and 20 pmol each of Coa primers. A pre-PCR step at 94°C for 3 minutes was applied. A total of 35 PCR cycles were run under the following conditions: denaturation at 94°C for 45 seconds, annealing 55°C for 1 minute, and extension at 72°C for 2 minutes. As a final step sample was kept for 7 minutes at 72°C. After the thermal cycling step, ten microliters of the PCR-amplified product were analyzed by electrophoresis on a 1.5% agarose gel stained with 0.5 mg of ethidium bromide/ml. The molecular size marker, a 100-bp plus, (Vivantis Technologies) was run concurrently. Gels were visualized under UV illumination and photographed. RESULTS Figure 1. The amplification products of 16s primers specific for Staphylococcus spp. M:Marker 100-bp plus, (Vivantis Technologies), Lane 1 shows PCR products from S. aureus (ATCC 25923), Lane 2 shows S. epidermidis (ATCC 12228), Lane 3 and Lane 4 show PCR products from clinical specimens, and Lane 5 Negative Control (Distilled Water).
5. Figure 2. The amplification products of Coa primers specific for S. aureus. M:Marker 100-bp plus, (Vivantis Technologies), Lane 1 S. aureus (ATCC 25923), Lane 2 clinical specimens, Lane 3 S. epidermidis (ATCC 12228), and Lane 4 Clinical Specimen (Known CNS positive) and Lane 5 Negative Control (Distilled Water)
6. Figure 3. The amplification products of duplex PCR. M: Marker 100-bp plus, (Vivantis Technologies), Lane 1 S. aureus (ATCC 25923), Lane 2 clinical specimens, Lane 3 S. epidermidis (ATCC 12228), and Lane 4 Clinical
7. Specimen (Known CNS positive) and Lane 5 Negative Control (Distilled Water) [Duplex PCR for S. aureus and Staphylococci] 13