Partial Capsid Protein Gene Sequence Analysis of Apple Mosaic Virus Infecting Apple, Plum and Hazelnut in Turkey
Öz
Coat protein (CP)
sequences of Apple mosaic virus (ApMV)
isolates were obtained from apple, plum and hazelnut. These isolates were
initially tested by DAS-ELISA. Five out of 38 randomly selected apple, hazelnut
and plum trees in Isparta, Düzce and Amasya provinces, respectively were ApMV-infected
for determining similarities or differences among Turkish ApMV isolates. The
isolates were collected in 2008-2010. Amplification of target regions of
selected five isolates was conducted by RT-PCR using coat protein specific
primers. PCR products gave bands of 262 bp in gel electrophoresis. Sequence
data of 262 bp of the partial coat protein region of the ApMV isolates were
obtained using F 5’
AGTAATCCGAAAGGTCCGAATCCGAT 3’
primer. All sequences were compared with ApMV sequences in NCBI and our
sequences showed 88-99% similarities with those. Our isolates accession numbers
are as follows: HM245753, HM490310, HM490311, HM245751, HM245752. They were
located in the same group and it was not seen any differences among them.
Partial Capsid Protein Gene Sequence Analysis of Apple Mosaic Virus Infecting Apple, Plum and Hazelnut in Turkey
Öz
Coat protein (CP)
sequences of Apple mosaic virus (ApMV)
isolates were obtained from apple, plum and hazelnut. These isolates were
initially tested by DAS-ELISA. Five out of 38 randomly selected apple, hazelnut
and plum trees in Isparta, Düzce and Amasya provinces, respectively were ApMV-infected
for determining similarities or differences among Turkish ApMV isolates. The
isolates were collected in 2008-2010. Amplification of target regions of
selected five isolates was conducted by RT-PCR using coat protein specific
primers. PCR products gave bands of 262 bp in gel electrophoresis. Sequence
data of 262 bp of the partial coat protein region of the ApMV isolates were
obtained using F 5’
AGTAATCCGAAAGGTCCGAATCCGAT 3’
primer. All sequences were compared with ApMV sequences in NCBI and our
sequences showed 88-99% similarities with those. Our isolates accession numbers
are as follows: HM245753, HM490310, HM490311, HM245751, HM245752. They were
located in the same group and it was not seen any differences among them.
Ayrıntılar
| Diğer ID | Birol AKBAŞ Kemal DEĞİRMENCİ |
|---|---|
| Bölüm | Makaleler |
| Yazarlar | |
| Yayımlanma Tarihi | 6 Nisan 2014 |
| Yayımlandığı Sayı | Yıl 2012 Cilt: 41 Sayı: 1-2-3 |
